HEAT STRESS GENES DATABASE

Responsive genes in Aegilops Speltoides (accession pau 3809) and Triticum aestivum (accession pau C273)

Home

Sequence Id TRINITY_DN15900_c0_g1_i1
Heat Stress Genes A2a
Ensembl Plants
New Transcript Id TraesCS7B02G272500.1
Functional Annotation
Gene ontology XP_020200656.1
Protein family Detail
Type -
Transcripts Per Million
TPM 6.36
Fragments Per Kilobase of transcript per Million mapped reads
FPKM 9.83
Sequence CCCACGCCCTTCCTGAACAAGACGTACGAGGTGGTGGACGACCACAGCACGGACACCATCGTGTCG
TGGGGCGTCGCCGGGAACAGCTTCGTGGTGTGGGACGCCCACGCCTTCTCCATGGTGCTCCTCCCC
CGCTACTTCAAGCACTGCAACTTCTCCAGCTTCGTCCGCCAGCTCAACACCTATGTAAGTTTCTGC
CGATCAG
Metabolic Pathways
Description (loc_os03g53340.3 : 112.0) no description available & (at2g26150 : 102.0) member of Heat Stress Transcription Factor (Hsf) family. Involved in response to misfolded protein accumulation in the cytosol. Regulated by alternative splicing and non-sense-mediated decay.; heat shock transcription factor A2 (HSFA2);
Function FUNCTIONS IN: DNA binding, transcription activator activity, sequence-specific DNA binding transcription factor activity;
Involve In INVOLVED IN: in 7 processes;
Located In LOCATED IN: endomembrane system, nucleus;
Expressed In EXPRESSED IN: 8 plant structures;
Expressed_During EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage;
Domains/Interpro CONTAINS InterPro DOMAIN/s: Winged helix-turn-helix transcription repressor DNA-binding (InterPro:IPR011991), Heat shock factor (HSF)-type, DNA-binding (InterPro:IPR000232);
Best Arabiophosystemics BEST Arabidopsis thaliana protein match is: heat shock transcription factor A1D (TAIR:AT1G32330.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). & (reliability: 204.0) & (original description: len=205 path=[0:0-204])

Ensembl Plants
Sequence Id	TRINITY_DN15900_c0_g1_i1
Heat Stress Genes	A2a
New Transcript Id	TraesCS7B02G272500.1
Functional Annotation
Gene ontology	XP_020200656.1
Protein family Detail
Type	-
Transcripts Per Million
TPM	6.36
Fragments Per Kilobase of transcript per Million mapped reads
FPKM	9.83
Sequence	CCCACGCCCTTCCTGAACAAGACGTACGAGGTGGTGGACGACCACAGCACGGACACCATCGTGTCG TGGGGCGTCGCCGGGAACAGCTTCGTGGTGTGGGACGCCCACGCCTTCTCCATGGTGCTCCTCCCC CGCTACTTCAAGCACTGCAACTTCTCCAGCTTCGTCCGCCAGCTCAACACCTATGTAAGTTTCTGC CGATCAG
Metabolic Pathways
Description	(loc_os03g53340.3 : 112.0) no description available & (at2g26150 : 102.0) member of Heat Stress Transcription Factor (Hsf) family. Involved in response to misfolded protein accumulation in the cytosol. Regulated by alternative splicing and non-sense-mediated decay.; heat shock transcription factor A2 (HSFA2);
Function	FUNCTIONS IN: DNA binding, transcription activator activity, sequence-specific DNA binding transcription factor activity;
Involve In	INVOLVED IN: in 7 processes;
Located In	LOCATED IN: endomembrane system, nucleus;
Expressed In	EXPRESSED IN: 8 plant structures;
Expressed_During	EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage;
Domains/Interpro	CONTAINS InterPro DOMAIN/s: Winged helix-turn-helix transcription repressor DNA-binding (InterPro:IPR011991), Heat shock factor (HSF)-type, DNA-binding (InterPro:IPR000232);
Best Arabiophosystemics	BEST Arabidopsis thaliana protein match is: heat shock transcription factor A1D (TAIR:AT1G32330.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). & (reliability: 204.0) & (original description: len=205 path=[0:0-204])