HEAT STRESS GENES DATABASE

Responsive genes in Aegilops Speltoides (accession pau 3809) and Triticum aestivum (accession pau C273)

Home

Sequence Id TRINITY_DN17376_c0_g1_i3
Heat Stress Genes B1
Ensembl Plants
New Transcript Id TraesCS7B02G168300.2
Functional Annotation
Gene ontology XP_020177659.1
Protein family Detail
Type -
Transcripts Per Million
TPM 3.9
Fragments Per Kilobase of transcript per Million mapped reads
FPKM 6.03
Sequence GGTCGTTCGTGGTGTGGAAGCCGGTGGAGCTGGCCCGCGACCTCCTCCCGCTCCACTTCAAGCACT
GCAACTTCTCCTCCTTCGTCCGCCAGCTCAACACCTACGGTTTCCGGAAGGTGGTGCCGGACCGGT
GGGAGTTCGCAAACGAGAACTTCCGGCGAGGCGAGCAAAGCCTCCTCTCCGGCATCCGTCGCCGCA
AGGCTACGGGGACGACGACTCCCCAGTCCTCCAAAACCTGCGGAACCGGC
Metabolic Pathways
Description (loc_os09g28354.1 : 154.0) no description available & (at5g62020 : 111.0) member of Heat Stress Transcription Factor (Hsf) family; heat shock transcription factor B2A (HSFB2A);
Function FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity;
Involve In INVOLVED IN: response to chitin;
Located In LOCATED IN: nucleus;18 plant structures;
Expressed In -
Expressed_During EXPRESSED DURING: 11 growth stages;
Domains/Interpro CONTAINS InterPro DOMAIN/s: Winged helix-turn-helix transcription repressor DNA-binding (InterPro:IPR011991), Heat shock factor (HSF)-type, DNA-binding (InterPro:IPR000232);
Best Arabiophosystemics BEST Arabidopsis thaliana protein match is: winged-helix DNA-binding transcription factor family protein (TAIR:AT4G11660.1); Has 2147 Blast hits to 2134 proteins in 224 species: Archae - 0; Bacteria - 0; Metazoa - 368; Fungi - 473; Plants - 782; Viruses - 0; Other Eukaryotes - 524 (source: NCBI BLink). & (reliability: 218.0) & (original description: len=248 path=[0:0-94 2:95-104 3:105-247])

Ensembl Plants
Sequence Id	TRINITY_DN17376_c0_g1_i3
Heat Stress Genes	B1
New Transcript Id	TraesCS7B02G168300.2
Functional Annotation
Gene ontology	XP_020177659.1
Protein family Detail
Type	-
Transcripts Per Million
TPM	3.9
Fragments Per Kilobase of transcript per Million mapped reads
FPKM	6.03
Sequence	GGTCGTTCGTGGTGTGGAAGCCGGTGGAGCTGGCCCGCGACCTCCTCCCGCTCCACTTCAAGCACT GCAACTTCTCCTCCTTCGTCCGCCAGCTCAACACCTACGGTTTCCGGAAGGTGGTGCCGGACCGGT GGGAGTTCGCAAACGAGAACTTCCGGCGAGGCGAGCAAAGCCTCCTCTCCGGCATCCGTCGCCGCA AGGCTACGGGGACGACGACTCCCCAGTCCTCCAAAACCTGCGGAACCGGC
Metabolic Pathways
Description	(loc_os09g28354.1 : 154.0) no description available & (at5g62020 : 111.0) member of Heat Stress Transcription Factor (Hsf) family; heat shock transcription factor B2A (HSFB2A);
Function	FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity;
Involve In	INVOLVED IN: response to chitin;
Located In	LOCATED IN: nucleus;18 plant structures;
Expressed In	-
Expressed_During	EXPRESSED DURING: 11 growth stages;
Domains/Interpro	CONTAINS InterPro DOMAIN/s: Winged helix-turn-helix transcription repressor DNA-binding (InterPro:IPR011991), Heat shock factor (HSF)-type, DNA-binding (InterPro:IPR000232);
Best Arabiophosystemics	BEST Arabidopsis thaliana protein match is: winged-helix DNA-binding transcription factor family protein (TAIR:AT4G11660.1); Has 2147 Blast hits to 2134 proteins in 224 species: Archae - 0; Bacteria - 0; Metazoa - 368; Fungi - 473; Plants - 782; Viruses - 0; Other Eukaryotes - 524 (source: NCBI BLink). & (reliability: 218.0) & (original description: len=248 path=[0:0-94 2:95-104 3:105-247])