HEAT STRESS GENES DATABASE

Responsive genes in Aegilops Speltoides (accession pau 3809) and Triticum aestivum (accession pau C273)

Home

Sequence Id TRINITY_DN17376_c0_g2_i1
Heat Stress Genes B2B
Ensembl Plants
New Transcript Id TraesCS7A02G360400.1
Functional Annotation
Gene ontology ACG25742.1
Protein family Detail
Type -
Transcripts Per Million
TPM 3.87
Fragments Per Kilobase of transcript per Million mapped reads
FPKM 5.98
Sequence GTGGACGACCCGGAGACCGACGACACCATCTCCTGGAACGAGTCCGGCACGGCGTTCGTGGTGTGG
CGCCGCGCCGAGTTCGAGCGCGACCTCCTCCCCAAGAACTTCAAGCACAGCAACTTCGCCTCCTTC
GTCCGCCAGCTCAACACCTACGGATTCAGGAAGATAGGCCTTGACAGGTGGGAGTTCGCCAACGAG
TGCTTCAGGAAAGGGGAGAAGCGCCTGCTCGGCGCGATACAGAGGCGGAAG
Metabolic Pathways
Description (loc_os04g48030.1 : 150.0) no description available & (at4g11660 : 132.0) member of Heat Stress Transcription Factor (Hsf) family; AT-HSFB2B;
Function FUNCTIONS IN: transcription repressor activity, sequence-specific DNA binding transcription factor activity;
Involve In INVOLVED IN: response to chitin;
Located In LOCATED IN: nucleus;
Expressed In EXPRESSED IN: 24 plant structures;
Expressed_During EXPRESSED DURING: 14 growth stages;
Domains/Interpro CONTAINS InterPro DOMAIN/s: Winged helix-turn-helix transcription repressor DNA-binding (InterPro:IPR011991), Heat shock factor (HSF)-type, DNA-binding (InterPro:IPR000232);
Best Arabiophosystemics BEST Arabidopsis thaliana protein match is: heat shock transcription factor B2A (TAIR:AT5G62020.1); Has 32476 Blast hits to 10764 proteins in 847 species: Archae - 36; Bacteria - 10454; Metazoa - 9035; Fungi - 1651; Plants - 6330; Viruses - 666; Other Eukaryotes - 4304 (source: NCBI BLink). & (reliability: 264.0) & (original description: len=249 path=[0:0-248])

Ensembl Plants
Sequence Id	TRINITY_DN17376_c0_g2_i1
Heat Stress Genes	B2B
New Transcript Id	TraesCS7A02G360400.1
Functional Annotation
Gene ontology	ACG25742.1
Protein family Detail
Type	-
Transcripts Per Million
TPM	3.87
Fragments Per Kilobase of transcript per Million mapped reads
FPKM	5.98
Sequence	GTGGACGACCCGGAGACCGACGACACCATCTCCTGGAACGAGTCCGGCACGGCGTTCGTGGTGTGG CGCCGCGCCGAGTTCGAGCGCGACCTCCTCCCCAAGAACTTCAAGCACAGCAACTTCGCCTCCTTC GTCCGCCAGCTCAACACCTACGGATTCAGGAAGATAGGCCTTGACAGGTGGGAGTTCGCCAACGAG TGCTTCAGGAAAGGGGAGAAGCGCCTGCTCGGCGCGATACAGAGGCGGAAG
Metabolic Pathways
Description	(loc_os04g48030.1 : 150.0) no description available & (at4g11660 : 132.0) member of Heat Stress Transcription Factor (Hsf) family; AT-HSFB2B;
Function	FUNCTIONS IN: transcription repressor activity, sequence-specific DNA binding transcription factor activity;
Involve In	INVOLVED IN: response to chitin;
Located In	LOCATED IN: nucleus;
Expressed In	EXPRESSED IN: 24 plant structures;
Expressed_During	EXPRESSED DURING: 14 growth stages;
Domains/Interpro	CONTAINS InterPro DOMAIN/s: Winged helix-turn-helix transcription repressor DNA-binding (InterPro:IPR011991), Heat shock factor (HSF)-type, DNA-binding (InterPro:IPR000232);
Best Arabiophosystemics	BEST Arabidopsis thaliana protein match is: heat shock transcription factor B2A (TAIR:AT5G62020.1); Has 32476 Blast hits to 10764 proteins in 847 species: Archae - 36; Bacteria - 10454; Metazoa - 9035; Fungi - 1651; Plants - 6330; Viruses - 666; Other Eukaryotes - 4304 (source: NCBI BLink). & (reliability: 264.0) & (original description: len=249 path=[0:0-248])