HEAT STRESS GENES DATABASE

Responsive genes in Aegilops Speltoides (accession pau 3809) and Triticum aestivum (accession pau C273)

Home

Sequence Id TRINITY_DN22641_c0_g1_i1
Heat Stress Genes A2
Ensembl Plants
New Transcript Id TraesCS5D02G445100.1
Functional Annotation
Gene ontology AIY25733.1
Protein family Detail
Type Domain
Transcripts Per Million
TPM 2.99
Fragments Per Kilobase of transcript per Million mapped reads
FPKM 4.61
Sequence AAGCACAGCAACTTCTCCAGCTTCGTCCGTCAGCTCAACACCTACGGTTTTAGAAAGATCGATCCA
GACAGATGGGAATTCGCGAACGAGGGTTTCATTCGGGGCCAGAGACAGCTTCTGAAGATGATAAAG
AGAAGGAGGTCATTGTCCTATCTCCCTTCATCACAGCAGCAGGCCCTTGGCTCTTGCCTCGAGGTC
GGCCAGTTCGGATTCGACGAAGAAATCGAAGTGCTAAAGCGCGACAAGAACGCCTTACTCGAAGAG
GTGGTGAAACTGAGGCAGGAGCAGCAGAGCAGCAGAGCTGACATGCGAGCCATGGAAGAGAGGCTG
CACCGCGTCGAGCAGAAGCAGCTCCAGATGATGGGTTTCCTGGCAAGAGCGATACAGAACCC
Metabolic Pathways
Description (loc_os03g06630.2 : 214.0) no description available & (at2g26150 : 169.0) member of Heat Stress Transcription Factor (Hsf) family. Involved in response to misfolded protein accumulation in the cytosol. Regulated by alternative splicing and non-sense-mediated decay.; heat shock transcription factor A2 (HSFA2);
Function FUNCTIONS IN: DNA binding, transcription activator activity, sequence-specific DNA binding transcription factor activity;
Involve In INVOLVED IN: in 7 processes;
Located In LOCATED IN: endomembrane system, nucleus;
Expressed In EXPRESSED IN: 8 plant structures;
Expressed_During EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage;
Domains/Interpro CONTAINS InterPro DOMAIN/s: Winged helix-turn-helix transcription repressor DNA-binding (InterPro:IPR011991), Heat shock factor (HSF)-type, DNA-binding (InterPro:IPR000232);
Best Arabiophosystemics BEST Arabidopsis thaliana protein match is: heat shock transcription factor A1D (TAIR:AT1G32330.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). & (reliability: 338.0) & (original description: len=392 path=[0:0-391])

Ensembl Plants
Sequence Id	TRINITY_DN22641_c0_g1_i1
Heat Stress Genes	A2
New Transcript Id	TraesCS5D02G445100.1
Functional Annotation
Gene ontology	AIY25733.1
Protein family Detail
Type	Domain
Transcripts Per Million
TPM	2.99
Fragments Per Kilobase of transcript per Million mapped reads
FPKM	4.61
Sequence	AAGCACAGCAACTTCTCCAGCTTCGTCCGTCAGCTCAACACCTACGGTTTTAGAAAGATCGATCCA GACAGATGGGAATTCGCGAACGAGGGTTTCATTCGGGGCCAGAGACAGCTTCTGAAGATGATAAAG AGAAGGAGGTCATTGTCCTATCTCCCTTCATCACAGCAGCAGGCCCTTGGCTCTTGCCTCGAGGTC GGCCAGTTCGGATTCGACGAAGAAATCGAAGTGCTAAAGCGCGACAAGAACGCCTTACTCGAAGAG GTGGTGAAACTGAGGCAGGAGCAGCAGAGCAGCAGAGCTGACATGCGAGCCATGGAAGAGAGGCTG CACCGCGTCGAGCAGAAGCAGCTCCAGATGATGGGTTTCCTGGCAAGAGCGATACAGAACCC
Metabolic Pathways
Description	(loc_os03g06630.2 : 214.0) no description available & (at2g26150 : 169.0) member of Heat Stress Transcription Factor (Hsf) family. Involved in response to misfolded protein accumulation in the cytosol. Regulated by alternative splicing and non-sense-mediated decay.; heat shock transcription factor A2 (HSFA2);
Function	FUNCTIONS IN: DNA binding, transcription activator activity, sequence-specific DNA binding transcription factor activity;
Involve In	INVOLVED IN: in 7 processes;
Located In	LOCATED IN: endomembrane system, nucleus;
Expressed In	EXPRESSED IN: 8 plant structures;
Expressed_During	EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage;
Domains/Interpro	CONTAINS InterPro DOMAIN/s: Winged helix-turn-helix transcription repressor DNA-binding (InterPro:IPR011991), Heat shock factor (HSF)-type, DNA-binding (InterPro:IPR000232);
Best Arabiophosystemics	BEST Arabidopsis thaliana protein match is: heat shock transcription factor A1D (TAIR:AT1G32330.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). & (reliability: 338.0) & (original description: len=392 path=[0:0-391])