HEAT STRESS GENES DATABASE

Responsive genes in Aegilops Speltoides (accession pau 3809) and Triticum aestivum (accession pau C273)

Home

Sequence Id TRINITY_DN43535_c0_g1_i1
Heat Stress Genes A3
Ensembl Plants
New Transcript Id TraesCS7D02G367700.1
Functional Annotation
Gene ontology XP_020146599.1
Protein family Detail
Type -
Transcripts Per Million
TPM 1.83
Fragments Per Kilobase of transcript per Million mapped reads
FPKM 2.83
Sequence GTTAGTTTTGCTCATCACCTGATCCTGCCACCGCGGCCCATGGAGGCACTGTTGCAGGGGCCGCAG
CTGCCACCATTCCTGTCCAAGACGTACGATCTCGAAGGCGAGCCGCAGCTGGACGGGGTCATCTCC
TGGGGTCCCGCCGGCAAGAGCTTCGTCGTGTGGAATCCTTCCACCTTCGCCCTGGACGTGCTCCTG
CACAACTTCGAGCACAACTTCTCCAGCTTCGTCA
Metabolic Pathways
Description (loc_os02g32590.2 : 118.0) no description available & (at5g03720 : 80.9) Member of Heat Stress Transcription Factor (Hsf) family. Expression is regulated by DREB2A and in turn HSFA3 regulates the expression of hsps Hsp18.1-CI and Hsp26.5-MII35S. Involved in establishing thermotolerence.; heat shock transcription factor A3 (HSFA3);
Function FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity;
Involve In INVOLVED IN: response to heat, regulation of transcription, DNA-dependent, response to chitin;
Located In LOCATED IN: nucleus;
Expressed In EXPRESSED IN: 13 plant structures;
Expressed_During EXPRESSED DURING: 9 growth stages;
Domains/Interpro CONTAINS InterPro DOMAIN/s: Winged helix-turn-helix transcription repressor DNA-binding (InterPro:IPR011991), Heat shock factor (HSF)-type, DNA-binding (InterPro:IPR000232);
Best Arabiophosystemics BEST Arabidopsis thaliana protein match is: heat shock transcription factor A1D (TAIR:AT1G32330.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). & (reliability: 161.8) & (original description: len=232 path=[0:0-231])

Ensembl Plants
Sequence Id	TRINITY_DN43535_c0_g1_i1
Heat Stress Genes	A3
New Transcript Id	TraesCS7D02G367700.1
Functional Annotation
Gene ontology	XP_020146599.1
Protein family Detail
Type	-
Transcripts Per Million
TPM	1.83
Fragments Per Kilobase of transcript per Million mapped reads
FPKM	2.83
Sequence	GTTAGTTTTGCTCATCACCTGATCCTGCCACCGCGGCCCATGGAGGCACTGTTGCAGGGGCCGCAG CTGCCACCATTCCTGTCCAAGACGTACGATCTCGAAGGCGAGCCGCAGCTGGACGGGGTCATCTCC TGGGGTCCCGCCGGCAAGAGCTTCGTCGTGTGGAATCCTTCCACCTTCGCCCTGGACGTGCTCCTG CACAACTTCGAGCACAACTTCTCCAGCTTCGTCA
Metabolic Pathways
Description	(loc_os02g32590.2 : 118.0) no description available & (at5g03720 : 80.9) Member of Heat Stress Transcription Factor (Hsf) family. Expression is regulated by DREB2A and in turn HSFA3 regulates the expression of hsps Hsp18.1-CI and Hsp26.5-MII35S. Involved in establishing thermotolerence.; heat shock transcription factor A3 (HSFA3);
Function	FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity;
Involve In	INVOLVED IN: response to heat, regulation of transcription, DNA-dependent, response to chitin;
Located In	LOCATED IN: nucleus;
Expressed In	EXPRESSED IN: 13 plant structures;
Expressed_During	EXPRESSED DURING: 9 growth stages;
Domains/Interpro	CONTAINS InterPro DOMAIN/s: Winged helix-turn-helix transcription repressor DNA-binding (InterPro:IPR011991), Heat shock factor (HSF)-type, DNA-binding (InterPro:IPR000232);
Best Arabiophosystemics	BEST Arabidopsis thaliana protein match is: heat shock transcription factor A1D (TAIR:AT1G32330.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). & (reliability: 161.8) & (original description: len=232 path=[0:0-231])