HEAT STRESS GENES DATABASE

Responsive genes in Aegilops Speltoides (accession pau 3809) and Triticum aestivum (accession pau C273)

Home

Sequence Id TRINITY_DN6304_c0_g2_i1
Heat Stress Genes C1
Ensembl Plants
New Transcript Id TraesCS7B02G272500.1
Functional Annotation
Gene ontology BAK01600.1
Protein family Detail
Type -
Transcripts Per Million
TPM 13.21
Fragments Per Kilobase of transcript per Million mapped reads
FPKM 20.4
Sequence GTGCGTCTGGCCCCGGAGGAAGGAGCCGTGGGCGAACTCCCACCGGTCCGGATCCACCTTGCGGAA
GCCATAGGTGTTGAGCTGGCGGACGAAGCTGGAGAAGTTGTTGTGCTTGAAGTGCGCGGGCAGCAT
GGTCTGCGAGAAGACGAAGGGGTCGGCGACGACGAAGCTGTTGTTCCCCTTCCCCCACCCGATGAC
CCCGTCCGTCCCGGGGTCCTCCACCATCCGGTACGTCTTCCACACGAACGGCGCCGC
Metabolic Pathways
Description (loc_os06g35960.1 : 184.0) no description available & (at3g24520 : 137.0) member of Heat Stress Transcription Factor (Hsf) family; heat shock transcription factor C1 (HSFC1);
Function FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity;
Involve In INVOLVED IN: regulation of transcription, DNA-dependent;
Located In LOCATED IN: nucleus;
Expressed In EXPRESSED IN: 14 plant structures;
Expressed_During EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, 4 anthesis, petal differentiation and expansion stage, LP.08 eight leaves visible;
Domains/Interpro CONTAINS InterPro DOMAIN/s: Winged helix-turn-helix transcription repressor DNA-binding (InterPro:IPR011991), Interferon induced 35kDa, N-terminal (InterPro:IPR009938), Heat shock factor (HSF)-type, DNA-binding (InterPro:IPR000232);
Best Arabiophosystemics BEST Arabidopsis thaliana protein match is: heat shock factor 1 (TAIR:AT4G17750.1); Has 2230 Blast hits to 2217 proteins in 240 species: Archae - 2; Bacteria - 4; Metazoa - 382; Fungi - 481; Plants - 788; Viruses - 0; Other Eukaryotes - 573 (source: NCBI BLink). & (reliability: 256.0) & (original description: len=255 path=[0:0-254])

Ensembl Plants
Sequence Id	TRINITY_DN6304_c0_g2_i1
Heat Stress Genes	C1
New Transcript Id	TraesCS7B02G272500.1
Functional Annotation
Gene ontology	BAK01600.1
Protein family Detail
Type	-
Transcripts Per Million
TPM	13.21
Fragments Per Kilobase of transcript per Million mapped reads
FPKM	20.4
Sequence	GTGCGTCTGGCCCCGGAGGAAGGAGCCGTGGGCGAACTCCCACCGGTCCGGATCCACCTTGCGGAA GCCATAGGTGTTGAGCTGGCGGACGAAGCTGGAGAAGTTGTTGTGCTTGAAGTGCGCGGGCAGCAT GGTCTGCGAGAAGACGAAGGGGTCGGCGACGACGAAGCTGTTGTTCCCCTTCCCCCACCCGATGAC CCCGTCCGTCCCGGGGTCCTCCACCATCCGGTACGTCTTCCACACGAACGGCGCCGC
Metabolic Pathways
Description	(loc_os06g35960.1 : 184.0) no description available & (at3g24520 : 137.0) member of Heat Stress Transcription Factor (Hsf) family; heat shock transcription factor C1 (HSFC1);
Function	FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity;
Involve In	INVOLVED IN: regulation of transcription, DNA-dependent;
Located In	LOCATED IN: nucleus;
Expressed In	EXPRESSED IN: 14 plant structures;
Expressed_During	EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, 4 anthesis, petal differentiation and expansion stage, LP.08 eight leaves visible;
Domains/Interpro	CONTAINS InterPro DOMAIN/s: Winged helix-turn-helix transcription repressor DNA-binding (InterPro:IPR011991), Interferon induced 35kDa, N-terminal (InterPro:IPR009938), Heat shock factor (HSF)-type, DNA-binding (InterPro:IPR000232);
Best Arabiophosystemics	BEST Arabidopsis thaliana protein match is: heat shock factor 1 (TAIR:AT4G17750.1); Has 2230 Blast hits to 2217 proteins in 240 species: Archae - 2; Bacteria - 4; Metazoa - 382; Fungi - 481; Plants - 788; Viruses - 0; Other Eukaryotes - 573 (source: NCBI BLink). & (reliability: 256.0) & (original description: len=255 path=[0:0-254])